Review



nikon nis elements c software  (Nikon)


Bioz Verified Symbol Nikon is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Nikon nikon nis elements c software
    Nikon Nis Elements C Software, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 39764 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nis+elements+c+software/NIS-Elements/pmc12962856-145-13-13
    Average 99 stars, based on 39764 article reviews
    nikon nis elements c software - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Microscopy:

    Article Title: Brain‐Specific Gata4 Downregulation in Greywick Female Mice Models the Metabolic Subtype of Polycystic Ovary Syndrome
    Article Snippet: .. A Nikon A1 confocal microscope equipped with NIS‐Elements C software (Nikon) was used to acquire images, which were then analyzed using ImageJ. ..

    Article Title: Homozygosity for a hypomorphic mutation in frizzled class receptor 5 causes syndromic ocular coloboma with microcornea in humans
    Article Snippet: .. Imaging was performed in a Nikon A1R inverted confocal microscope with a 40X dry lens and images were processed with Nikon NIS Elements C software. .. pCS2- wt-fzd5-RFP and pCS2- mi-fzd5-RFP were used as templates to generate myc-tagged forms for transfection, using the the NEB Q5 site-directed mutagenesis kit (E0554; forward primer AGCGAAGAAGATCTGTAGAACTATAGTGAGTCGTATTAC; reverse primer AATCAGTTTCTGTTCGAGGACATGTGATGAG).

    Article Title: Cell cycle-regulated tug-of-war between microtubule motors positions major trafficking organelles
    Article Snippet: Coverslips were mounted in Vectashield Antifade Mounting Medium (Vector Labs, Burlingame, CA). .. Fixed samples were imaged using a Nikon A1R laser scanning confocal microscope equipped with a TiE motorized inverted base and an SR Apo TIRF 100X NA 1.49 lens, controlled via NIS Elements C software (Nikon, Tokyo, Japan). ..

    Article Title: Melastatin subfamily Transient Receptor Potential channels support spermatogenesis in planarian flatworms
    Article Snippet: Samples used in FISH analyses were incubated in anti-DIG-POD antibody solution (1:2000 dilution; Roche Diagnostics, Mannheim, Germany) rocking overnight at 4°C. .. The FISH samples were developed using FAM tyramide solution as described by , washed, and mounted in 80% glycerol/20% PBS and imaged using a Nikon C2+ confocal microscope with NIS Elements C software. .. Initial observations of distribution of expression of TRPM homologs were performed using riboprobes generated from GeneArt DNA fragments, and Smed-TRPM-c expression was validated in colorimetric and FISH analyses using riboprobes generated from full-length ORF clones.

    Article Title: Homozygosity for a hypomorphic mutation in frizzled class receptor 5 causes syndromic ocular coloboma with microcornea in humans.
    Article Snippet: .. Imaging was performed in a Nikon A1R inverted confocal microscope with a 40X dry lens and images were processed with Nikon NIS Elements C software. .. pCS2-wt-fzd5-RFP and pCS2-mi-fzd5-RFP were used as templates to generate myc-tagged forms for transfection, using the the NEB Q5 site-directed mutagenesis kit (E0554; forward primer A G C G A A G A A G A T C T G T A G A A C T A T A G T G A G T C G T A T T A C; reverse primer A A T C A G T T T C T G T T C G A G G A C A T G T G A T G A G).

    Software:

    Article Title: Brain‐Specific Gata4 Downregulation in Greywick Female Mice Models the Metabolic Subtype of Polycystic Ovary Syndrome
    Article Snippet: .. A Nikon A1 confocal microscope equipped with NIS‐Elements C software (Nikon) was used to acquire images, which were then analyzed using ImageJ. ..

    Article Title: RNF4 and USP7 coordinate spatial regulation of SLX4 stability within the PML nuclear bodies
    Article Snippet: .. The intensity profile of the foci was measured using NIS elements C software (Nikon). .. A Duolink kit (Sigma–Aldrich) was used to conduct the proximity ligation assay (PLA) according to the manufacturer’s instructions.

    Article Title: Homozygosity for a hypomorphic mutation in frizzled class receptor 5 causes syndromic ocular coloboma with microcornea in humans
    Article Snippet: .. Imaging was performed in a Nikon A1R inverted confocal microscope with a 40X dry lens and images were processed with Nikon NIS Elements C software. .. pCS2- wt-fzd5-RFP and pCS2- mi-fzd5-RFP were used as templates to generate myc-tagged forms for transfection, using the the NEB Q5 site-directed mutagenesis kit (E0554; forward primer AGCGAAGAAGATCTGTAGAACTATAGTGAGTCGTATTAC; reverse primer AATCAGTTTCTGTTCGAGGACATGTGATGAG).

    Article Title: Cell cycle-regulated tug-of-war between microtubule motors positions major trafficking organelles
    Article Snippet: Coverslips were mounted in Vectashield Antifade Mounting Medium (Vector Labs, Burlingame, CA). .. Fixed samples were imaged using a Nikon A1R laser scanning confocal microscope equipped with a TiE motorized inverted base and an SR Apo TIRF 100X NA 1.49 lens, controlled via NIS Elements C software (Nikon, Tokyo, Japan). ..

    Article Title: Melastatin subfamily Transient Receptor Potential channels support spermatogenesis in planarian flatworms
    Article Snippet: Samples used in FISH analyses were incubated in anti-DIG-POD antibody solution (1:2000 dilution; Roche Diagnostics, Mannheim, Germany) rocking overnight at 4°C. .. The FISH samples were developed using FAM tyramide solution as described by , washed, and mounted in 80% glycerol/20% PBS and imaged using a Nikon C2+ confocal microscope with NIS Elements C software. .. Initial observations of distribution of expression of TRPM homologs were performed using riboprobes generated from GeneArt DNA fragments, and Smed-TRPM-c expression was validated in colorimetric and FISH analyses using riboprobes generated from full-length ORF clones.

    Article Title: frizzled 5 mutant zebrafish are genetically sensitised to developing microphthalmia and coloboma
    Article Snippet: Imaging of dome-stage embryos and transfected mammalian cells expressing wt-Fzd5-RFP and Fzd5 sgu3 -RFP fusions was performed in a Nikon A1R inverted confocal microscope with a 40× dry lens or a 100× oil immersion lens, respectively. .. Images were acquired with Nikon NIS Elements C software. ..

    Article Title: Homozygosity for a hypomorphic mutation in frizzled class receptor 5 causes syndromic ocular coloboma with microcornea in humans.
    Article Snippet: .. Imaging was performed in a Nikon A1R inverted confocal microscope with a 40X dry lens and images were processed with Nikon NIS Elements C software. .. pCS2-wt-fzd5-RFP and pCS2-mi-fzd5-RFP were used as templates to generate myc-tagged forms for transfection, using the the NEB Q5 site-directed mutagenesis kit (E0554; forward primer A G C G A A G A A G A T C T G T A G A A C T A T A G T G A G T C G T A T T A C; reverse primer A A T C A G T T T C T G T T C G A G G A C A T G T G A T G A G).

    Article Title: DNA fork remodeling proteins, Zranb3 and Smarcal1, are uniquely essential for aging hematopoiesis
    Article Snippet: .. Images were captured and analyzed on Nikon C2 or A1R laser scanning confocal microscopes using 40× (1.3NA, oil) or 60× (1.4NA, oil) objectives at 0.21 μm/px using NIS‐elements C software (Nikon). ..

    Imaging:

    Article Title: Homozygosity for a hypomorphic mutation in frizzled class receptor 5 causes syndromic ocular coloboma with microcornea in humans
    Article Snippet: .. Imaging was performed in a Nikon A1R inverted confocal microscope with a 40X dry lens and images were processed with Nikon NIS Elements C software. .. pCS2- wt-fzd5-RFP and pCS2- mi-fzd5-RFP were used as templates to generate myc-tagged forms for transfection, using the the NEB Q5 site-directed mutagenesis kit (E0554; forward primer AGCGAAGAAGATCTGTAGAACTATAGTGAGTCGTATTAC; reverse primer AATCAGTTTCTGTTCGAGGACATGTGATGAG).

    Article Title: Homozygosity for a hypomorphic mutation in frizzled class receptor 5 causes syndromic ocular coloboma with microcornea in humans.
    Article Snippet: .. Imaging was performed in a Nikon A1R inverted confocal microscope with a 40X dry lens and images were processed with Nikon NIS Elements C software. .. pCS2-wt-fzd5-RFP and pCS2-mi-fzd5-RFP were used as templates to generate myc-tagged forms for transfection, using the the NEB Q5 site-directed mutagenesis kit (E0554; forward primer A G C G A A G A A G A T C T G T A G A A C T A T A G T G A G T C G T A T T A C; reverse primer A A T C A G T T T C T G T T C G A G G A C A T G T G A T G A G).

    Fluorescence In Situ Hybridization:

    Article Title: Melastatin subfamily Transient Receptor Potential channels support spermatogenesis in planarian flatworms
    Article Snippet: Samples used in FISH analyses were incubated in anti-DIG-POD antibody solution (1:2000 dilution; Roche Diagnostics, Mannheim, Germany) rocking overnight at 4°C. .. The FISH samples were developed using FAM tyramide solution as described by , washed, and mounted in 80% glycerol/20% PBS and imaged using a Nikon C2+ confocal microscope with NIS Elements C software. .. Initial observations of distribution of expression of TRPM homologs were performed using riboprobes generated from GeneArt DNA fragments, and Smed-TRPM-c expression was validated in colorimetric and FISH analyses using riboprobes generated from full-length ORF clones.



    Similar Products

    99
    Nikon nikon nis elements c software
    Nikon Nis Elements C Software, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nis+elements+c+software/NIS-Elements/pmc12962856-145-13-13
    Average 99 stars, based on 1 article reviews
    nikon nis elements c software - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Nikon niselements c software
    Niselements C Software, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nis+elements+c+software/NIS-Elements/pm41821050-193-7-10
    Average 99 stars, based on 1 article reviews
    niselements c software - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Nikon nis elements c software
    Nis Elements C Software, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nis+elements+c+software/NIS-Elements/pmc12464815-89-9-13
    Average 99 stars, based on 1 article reviews
    nis elements c software - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Nikon 365 light engine nikon nis elements software nikon c fl surface reflection interference
    365 Light Engine Nikon Nis Elements Software Nikon C Fl Surface Reflection Interference, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nis+elements+c+software/NIS-Elements/pmc12512101__ja5c05203_si_001-10-20-23
    Average 99 stars, based on 1 article reviews
    365 light engine nikon nis elements software nikon c fl surface reflection interference - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    90
    Nikon software nis- elements c
    Software Nis Elements C, supplied by Nikon, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nis+elements+c+software/pm40542554-58-39-41
    Average 90 stars, based on 1 article reviews
    software nis- elements c - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    99
    Nikon image analysis software nis elements c
    Image Analysis Software Nis Elements C, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nis+elements+c+software/NIS-Elements/pmc12181770-45-32-37
    Average 99 stars, based on 1 article reviews
    image analysis software nis elements c - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results